The nucleotide sequence of the chloroplast 5S ribosomal RNA from spinach.

AUTOR(ES)

Delihas, N

RESUMO

Spinacia oleracia cholorplast 5S ribosomal RNA was end-labeled with [32P] and the complete nucleotide sequence was determined. The sequence is: pUAUUCUGGUGUCCUAGGCGUAGAGGAACCACACCAAUCCAUCCCGAACUUGGUGGUUAAACUCUACUGCGGUGACGAU ACUGUAGGGGAGGUCCUGCGGAAAAAUAGCUCGACGCCAGGAUGOH. This sequence can be fitted to the secondary structural model proposed for prokaryotic 5S ribosomal RNAs by Fox and Woese (1). However, the lengths of several single- and double-stranded regions differ from those common to prokaryotes. The spinach chloroplast 5S ribosomal RNA is homologous to the 5S ribosomal RNA of Lemna chloroplasts with the exception that the spinach RNA is longer by one nucleotide at the 3' end and has a purine base substitution at position 119. The sequence of spinach chloroplast 5S RNA is identical to the chloroplast 5S ribosomal RNA gene of tobacco. Thus the structures of the chloroplast 5S ribosomal RNAs from some of the higher plants appear to be almost totally conserved. This does not appear to be the case for the higher plant cytoplasmic 5S ribosomal RNAs.

Documentos Relacionados

• The nucleotide sequence of chloroplast 5S ribosomal RNA from a fern, Dryopteris acuminata.
• The nucleotide sequence of ribosomal 5S RNA from lettuce seeds.
• The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.
• Nucleotide sequence of 5S ribosomal RNA from Rhodococcus erythropolis.
• Size heterogeneity in Spinacia oleracea (spinach) chloroplast 5S ribosomal RNA.